Review



baf457  (r&d systems)


Bioz Verified Symbol r&d systems is a verified supplier
Bioz Manufacturer Symbol r&d systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    r&d systems baf457
    KEY RESOURCES TABLE
    Baf457, supplied by r&d systems, used in various techniques. Bioz Stars score: 92/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pmc11845304-2-0-10
    Average 92 stars, based on 17 article reviews
    baf457 - by Bioz Stars, 2026-09
    92/100 stars

    Images

    1) Product Images from "Inflammation switches the chemoattractant requirements for naive lymphocyte entry into lymph nodes"

    Article Title: Inflammation switches the chemoattractant requirements for naive lymphocyte entry into lymph nodes

    Journal: Cell

    doi: 10.1016/j.cell.2024.11.031

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Control, Virus, Recombinant, Adjuvant, Reverse Transcription, RNAscope, SYBR Green Assay, Plasmid Preparation, Software

    Related Articles

    Magnetic Cell Separation:

    Article Title: Visualization of T Cell Migration in the Spleen Reveals a Network of Perivascular Pathways that Guide Entry into T Zones
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Biotin B220, clone RA3-6B2 Biolegend Cat #: 103204; RRID: AB_312989 Biotin Cd11b, clone M1/70 Biolegend Cat #: 101204 RRID: AB_312787 Biotin Ly6G, clone 1A8 Biolegend Cat #: 127604; RRID: AB_1186108 Biotin CD49b, clone DX5 Biolegend Cat #: 108904; RRID: AB_313411 PE CD45, clone 30F11 Biolegend Cat #: 103106; RRID: AB_312971 PerCP/Cy5.5 TER119 Biolegend Cat #: 116227; RRID: AB_893638 PE CD19, clone 6D5 Biolegend Cat #: 115508; RRID: AB_313643 PE CD3, clone 17A2 Biolegend Cat #: 100206; RRID: AB_312663 Alexa700 B220, clone RA3-682 Biolegend Cat #: 103232; RRID: AB_493717 APC CD3, clone 145-2C11 Biolegend Cat #: 100236; RRID: AB_2561456 BV785 CD4, clone RM4-5 Biolegend Cat #: 100552; RRID: AB_2563053 BV605 CD8, clone 53-6.7 Biolegend Cat #: 100744; RRID: AB_2562609 APC-Cy7 CD45, clone 30-F11 Biolegend Cat #: 103116; RRID: AB_312981 APC-Cy7 TER119, clone TER-119 Biolegend Cat #: 116223; RRID: AB_2137788 APC CD31, clone MEC13.3 Biolegend Cat #: 102410; RRID: AB_312905 PE Podoplanin, GP38, clone 8.1.1 Biolegend Cat #: 127408; RRID: AB_2161928 Integrin alpha4, CD49d, clone PS/2 BioXcell Cat #: BE0071; RRID: AB_1107657 Integrin alphaL, CD11a, clone M17/4 BioXcell Cat #: BE0006; RRID: AB_1107578 FITC CD169, clone 3D6.112 BIO-RAD Cat #: MCA884FT; RRID: AB_1100895 GFP, rabbit polyclonal Thermo Fisher Cat #: A-11122; RRID: AB_221569 Alkaline Phosphatase anti-Fluorescein, polyclonal Sigma Cat #: 11426338910 Roche; RRID: AB_2734723 HRP anti-rabbit, polyclonal Thermo Fisher Cat #: 31460; RRID: AB_228341 Alexa647 CD169, clone 3D6.112 BIO-RAD Cat #: MCA947A647; RRID: AB_10545834 CD31, clone MEC13.3 BD Biosciences Cat #: 557355; RRID: AB_396660 (Continued on next page) e1 Immunity 52, 794–807.e1–e7, May 19, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER Biotin CD140b, PDGFR beta, clone APB5 Biolegend Cat #: 136010; RRID: AB_2236916 ER-TR7, clone ER-TR7 BioXcell Cat #: BE0253; RRID: AB_2687734 Biotin CCL21, polyclonal R&D systems Cat #: BAF457; RRID: AB_2072082 Podoplanin, GP38, clone 8-1-1 eBioscience Cat #: 14-5381-82; RRID: AB_1210505 Alexa488 anti-rat IgG Thermo Fisher Cat #: A21208; RRID: AB_2535794 eFluor660 anti-rat IgG Thermo Fisher Cat #: 50-4017-82; RRID: AB_2574211 Alexa488 anti-rabbit igG Thermo Fisher Cat #: A-11008; RRID: AB_143165 Alexa647 anti-Armenian hamster IgG Jackson ImmunoResearch Cat #: 127-605-160; RRID: AB-2339001 Biotin CD4 Biolegend Cat #: 100508; RRID: AB-312711 Alexa647 B220, clone RA3-6B2 Biolegend Cat #: 103226; RRID: AB-389330 Cy3 aplphaSMA, clone 1A4 Sigma Cat #: C6198-100UL; RRID: AB-476856 Rabbit anti-EYFP living colors full length GFP, polyclonal Takara Cat #: 632592; RRID: AB-2336883 Goat anti-CCL21 R&D systems Cat #: AF457; RRID: AB-2072083 Rat anti-ER-TR7 Abcam Cat #: ab51824; RRID: AB-881651 Alexa488 anti-rabbit IgG Jackson ImmunoResearch Cat #: 111-547-003; RRID: AB-2338058 Dylight549 anti-rat IgG Jackson ImmunoResearch Cat #: 112-505-175; RRID: AB-2338335 Dylight549 anti-Syrian Hamster IgG Jackson ImmunoResearch Cat #: 307-506-003; RRID: AB-2339595 Critical Commercial Assays Alexa488 streptavidin Invitrogen Cat #: S11223 Cy3 streptavidin Jackson ImmunoResearch Cat #: 016-160-084 Alexa647 streptavidin Jackson ImmunoResearch Cat #: 016-600-084 BioMag Goat anti-rat IgG QIAGEN Cat #: 310107 CFSE 5-(and 6-)-carboxyfluorescein diacetate succinimidyl ester Life Technologies Cat #: C1157 Cell tracker blue probe CMAC 7amino4chloromethylcoumarin Life Technologies Cat #: C2110 Cell Tracker orange CMTMR Life Technologies Cat #: C2927 Pertussis Toxin Islet Activating Protein Salt-Free (PTX) Quadratech Diagnostics Ltd. Cat #: 181 LPS, Escherichia coli 0111:B4 Sigma Aldrich Cat #: L4391 Dextran-FITC 2000KDa Sigma Aldrich Cat #: FD2000S Collagenase P Sigma Aldrich Cat #: 11213857001 Dispase I Sigma Aldrich Cat #: D4818-2MG MACS TER119 microbeads Miltenyi Biotec Cat #: 130-049-901 MACS CD45 microbeads Miltenyi Biotec Cat #: 130-052-301 (Continued on next page) ll Article Immunity 52, 794–807.e1–e7, May 19, 2020 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Actin-CFP mice, Tg(ACTB-ECFP)1Nagy/J Jackson Laboratory 004218 Ccr7 / mice, B6.129P2(C)-Ccr7tm1Rfor/J Jackson Laboratory 006621 Ubi-GFP mice, C57BL/6-Tg(UB C-GFP)30Scha/J Jackson Laboratory 004353 Rosa26-YFP mice, B6.129X1Gt(ROSA)26Sortm1(EYFP)cos/J Jackson Laboratory 001648 CD19cre/cre mice, B6.129P2(C)-Cd19tm1(Cre)Cgn/J Jackson Laboratory 006785 Tlr4 / mice, B6(Cg)-Tlr4tm1.2Karp/J Jackson Laboratory 029015 Ubi-PA-GFP mice, B6.Cg-PtprcaTg(UBCPA-GFP)1Mnz/J Jackson Laboratory 022486 hCD2-DsRred mice Veiga-Fernandes et al., 2007 N/A VE-cadherin-tdTomato, C57BL/6Tg(Cdh5-cre/ERT2)rosa26-TdTomato Kindly provided by Dr. Bostjan MArkelc, Oxford University N/A BAC-transgenic C57BL/6-Tg(Ccl19-tTA)687BIAT Available under MTA, laboratory of Dr. Burkhard Ludewig N/A LC1 Schönig et al., 2002 N/A Oligonucleotides qPCR primers Ccl19 FP: CTG CAA GAG AAC TGA ACA GAC Life Technologies N/A qPCR primers Ccl19 RP: CTT CTG ACT CTC TAG GTC TAC Life Technologies N/A qPCR primers Ccl21 FP: ATCGTGAAAGCCTTCGCTACCTT Life Technologies N/A qPCR primers Ccl21 RP: GCTGTTGCCTTTGTTCTTGGCAGA Life Technologies N/A qPCR primers GAPDH FP: AGGTCGGTGTGAACGGATTTG Life Technologies N/A qPCR primers GAPDH RP: TGTAGACCATGTAGTTGAGGTCA Life Technologies N/A QuantiTect Primers Hprt QIAGEN QT00166768 QuantiTect Primers Ccl19 QIAGEN QT02532173 QuantiTect Primers Ccl21a QIAGEN QT00284753 Software and Algorithms FlowJo 9.7.1 (Treestar inc) https://www.flowjo.com/ RRID: SCR_008520 Graphpad prism version 8 https://www.graphpad.com/scientific- software/prism/ RRID: SCR_002798 Adobe illustrator CS6 http://www.adobe.com/products/ illustrator.html RRID: SCR_010279 Imaris 9.2.1 http://www.bitplane.com/imaris/imaris RRID: SCR_007370 Fiji, ImageJ, NIH Bethesda http://fiji.sc/ RRID: SCR_002285 ZEN Digital Imaging for Light Microscopy http://www.zeiss.com/microscopy/en_us/ products/microscope-software/ zen.html#introduction RRID: SCR_013672 ll Article

    other:

    Article Title:
    Article Snippet: Goat Anti-Mouse Ccl21 / 6ckine Polyclonal antibody, Biotin Conjugated , R and D Systems , Cat# BAF457; RRID:AB_2072082.



    Similar Products

    92
    R&D Systems goat anti mouse ccl21
    CHS-induced dermal inflammation impairs DC entry into lymphatics in in vitro crawl-in assays but enhances their in vivo migration. (A) Current model of the different steps in DC migration from skin to dLNs and their documented dependence on <t>CCL21</t> gradients. DCs approach dermal lymphatics migrating along a perilymphatic CCL21 gradient (1). Upon entry into lymphatic capillaries (i), DCs actively migrate in a semidirected manner, following the immobilized CCL21 gradient (2) deposited in the capillary lumen (ii). Once lymph flow picks up due to LV contractions in collectors, DCs are passively transported (iii) to the LN SCS. Egress from the SCS into the LN parenchyma (iv) occurs along another CCL21 gradient (3) (B and C) Crawl-in assay: Mice were sensitized with 2% oxazolone on the belly on day 0 and challenged on day 5 by applying 1% oxazolone to the skin of one ear. Crawl-in assays with both ears, i.e., the CTR and the CHS-inflamed ear, were performed 1 day later by adding fluorescently labelled LPS-matured WT and CCR7 −/− bone marrow–derived DCs (1:1 ratio) onto the dermal ear skin to allow DCs to migrate into lymphatics for 4 h. (B) Representative images of WT and CCR7 −/− bone marrow–derived DCs and the vasculature (stained for CD31) at the end of the experiment. Scale bar: 100 μm. (C) Quantification of the ratio of WT (left) and CCR7 −/− (right) bone marrow–derived DCs located inside vs. outside of lymphatics. n = 4 experiments performed with 1 mouse each. Paired Student’s t test. (D–H) In vivo DC migration assay: 1:1 mixture of LPS-matured and CCR7 −/− DCs, labelled in two fluorescent colors, were transferred into either CHS-inflamed or uninflamed CTR footpads. DC numbers in draining popliteal LNs were quantified by flow cytometry 16–18 h later. (D) Popliteal LN weight. (E) Popliteal LN cellularity. (F) Gating scheme used for the identification of transferred DCs. (G) Quantification of DC numbers in popliteal LNs. Pooled data from six experiments are shown (total n = 25 CTR and n = 25 CHS). (H) Ratio of migrated WT:CCR7 −/− DCs per experiment. Statistics: unpaired (D, E, and F) and paired (H—since in same animal) Student’s t test.
    Goat Anti Mouse Ccl21, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pmc12839967-274-44-47
    Average 92 stars, based on 1 article reviews
    goat anti mouse ccl21 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    R&D Systems detection antibody
    CHS-induced dermal inflammation impairs DC entry into lymphatics in in vitro crawl-in assays but enhances their in vivo migration. (A) Current model of the different steps in DC migration from skin to dLNs and their documented dependence on <t>CCL21</t> gradients. DCs approach dermal lymphatics migrating along a perilymphatic CCL21 gradient (1). Upon entry into lymphatic capillaries (i), DCs actively migrate in a semidirected manner, following the immobilized CCL21 gradient (2) deposited in the capillary lumen (ii). Once lymph flow picks up due to LV contractions in collectors, DCs are passively transported (iii) to the LN SCS. Egress from the SCS into the LN parenchyma (iv) occurs along another CCL21 gradient (3) (B and C) Crawl-in assay: Mice were sensitized with 2% oxazolone on the belly on day 0 and challenged on day 5 by applying 1% oxazolone to the skin of one ear. Crawl-in assays with both ears, i.e., the CTR and the CHS-inflamed ear, were performed 1 day later by adding fluorescently labelled LPS-matured WT and CCR7 −/− bone marrow–derived DCs (1:1 ratio) onto the dermal ear skin to allow DCs to migrate into lymphatics for 4 h. (B) Representative images of WT and CCR7 −/− bone marrow–derived DCs and the vasculature (stained for CD31) at the end of the experiment. Scale bar: 100 μm. (C) Quantification of the ratio of WT (left) and CCR7 −/− (right) bone marrow–derived DCs located inside vs. outside of lymphatics. n = 4 experiments performed with 1 mouse each. Paired Student’s t test. (D–H) In vivo DC migration assay: 1:1 mixture of LPS-matured and CCR7 −/− DCs, labelled in two fluorescent colors, were transferred into either CHS-inflamed or uninflamed CTR footpads. DC numbers in draining popliteal LNs were quantified by flow cytometry 16–18 h later. (D) Popliteal LN weight. (E) Popliteal LN cellularity. (F) Gating scheme used for the identification of transferred DCs. (G) Quantification of DC numbers in popliteal LNs. Pooled data from six experiments are shown (total n = 25 CTR and n = 25 CHS). (H) Ratio of migrated WT:CCR7 −/− DCs per experiment. Statistics: unpaired (D, E, and F) and paired (H—since in same animal) Student’s t test.
    Detection Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pmc12839967-395-1-20
    Average 92 stars, based on 1 article reviews
    detection antibody - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    R&D Systems biotin
    CHS-induced dermal inflammation impairs DC entry into lymphatics in in vitro crawl-in assays but enhances their in vivo migration. (A) Current model of the different steps in DC migration from skin to dLNs and their documented dependence on <t>CCL21</t> gradients. DCs approach dermal lymphatics migrating along a perilymphatic CCL21 gradient (1). Upon entry into lymphatic capillaries (i), DCs actively migrate in a semidirected manner, following the immobilized CCL21 gradient (2) deposited in the capillary lumen (ii). Once lymph flow picks up due to LV contractions in collectors, DCs are passively transported (iii) to the LN SCS. Egress from the SCS into the LN parenchyma (iv) occurs along another CCL21 gradient (3) (B and C) Crawl-in assay: Mice were sensitized with 2% oxazolone on the belly on day 0 and challenged on day 5 by applying 1% oxazolone to the skin of one ear. Crawl-in assays with both ears, i.e., the CTR and the CHS-inflamed ear, were performed 1 day later by adding fluorescently labelled LPS-matured WT and CCR7 −/− bone marrow–derived DCs (1:1 ratio) onto the dermal ear skin to allow DCs to migrate into lymphatics for 4 h. (B) Representative images of WT and CCR7 −/− bone marrow–derived DCs and the vasculature (stained for CD31) at the end of the experiment. Scale bar: 100 μm. (C) Quantification of the ratio of WT (left) and CCR7 −/− (right) bone marrow–derived DCs located inside vs. outside of lymphatics. n = 4 experiments performed with 1 mouse each. Paired Student’s t test. (D–H) In vivo DC migration assay: 1:1 mixture of LPS-matured and CCR7 −/− DCs, labelled in two fluorescent colors, were transferred into either CHS-inflamed or uninflamed CTR footpads. DC numbers in draining popliteal LNs were quantified by flow cytometry 16–18 h later. (D) Popliteal LN weight. (E) Popliteal LN cellularity. (F) Gating scheme used for the identification of transferred DCs. (G) Quantification of DC numbers in popliteal LNs. Pooled data from six experiments are shown (total n = 25 CTR and n = 25 CHS). (H) Ratio of migrated WT:CCR7 −/− DCs per experiment. Statistics: unpaired (D, E, and F) and paired (H—since in same animal) Student’s t test.
    Biotin, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pmc11845304-2-7-10
    Average 92 stars, based on 1 article reviews
    biotin - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    r&d systems baf457
    KEY RESOURCES TABLE
    Baf457, supplied by r&d systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pmc11845304-2-0-10
    Average 92 stars, based on 1 article reviews
    baf457 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    94
    R&D Systems biotinylated anti mouse ccl21 antibody
    KEY RESOURCES TABLE
    Biotinylated Anti Mouse Ccl21 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pm37421165-35-45-51
    Average 94 stars, based on 1 article reviews
    biotinylated anti mouse ccl21 antibody - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    92
    R&D Systems anti mouse ccl21 antibody
    The host‐ and melanoma cell‐derived <t>CCL21‐Ser</t> expression contributes to tumor growth in WT control and the Ccl21a ‐KO mice. (A) Tumors were weighed 2 weeks after injection with cells derived from F10‐mock (WT; n = 47, KO; n = 41) and <t>F10‐ccl21</t> (WT; n = 54, KO; n = 45). Each plot shows an individual tumor. The data were analyzed by the Steel–Dwass test. Orange lines show the median. * p < 0.05, NS, not significant. (B) F10‐mock and F10‐ccl21 cells stably expressing click beetle luciferase were established and subcutaneously injected into WT or Ccl21a ‐KO on the B6 Albino background. Bioluminescence on Days 7, 10, and 14 of wild‐type mice with F10‐mock ( n = 10, 6, 10) and F10‐ Ccl21 ( n = 11, 7, 11) and KO mice with F10‐mock ( n = 9, 6, 9) and F10‐ Ccl21 ( n = 12, 5, 12) were measured. The average radiance of bioluminescence counts measured by IVIS Lumina system (p/s/cm 2 /sr) is shown. Orange lines show the median. Green dots show mild outliers. The data were analyzed by the Mann–Whitney U ‐test. * p < .05. (C) In vitro proliferation of B16‐F10‐derived cell lines stably transfected with the CCL21a expression or control plasmid. The cells were seeded in three wells at 1 × 10 3 cells/well, and the number of cells was counted on the indicated days. The graph shows the average values from three independent experiments. The significance test was performed by Student's t ‐test. Error bars indicate SEM. KO, knockout; WT, wild‐type.
    Anti Mouse Ccl21 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pmc10475776-68-33-37
    Average 92 stars, based on 1 article reviews
    anti mouse ccl21 antibody - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    R&D Systems mouse anti ccl21
    The host‐ and melanoma cell‐derived <t>CCL21‐Ser</t> expression contributes to tumor growth in WT control and the Ccl21a ‐KO mice. (A) Tumors were weighed 2 weeks after injection with cells derived from F10‐mock (WT; n = 47, KO; n = 41) and <t>F10‐ccl21</t> (WT; n = 54, KO; n = 45). Each plot shows an individual tumor. The data were analyzed by the Steel–Dwass test. Orange lines show the median. * p < 0.05, NS, not significant. (B) F10‐mock and F10‐ccl21 cells stably expressing click beetle luciferase were established and subcutaneously injected into WT or Ccl21a ‐KO on the B6 Albino background. Bioluminescence on Days 7, 10, and 14 of wild‐type mice with F10‐mock ( n = 10, 6, 10) and F10‐ Ccl21 ( n = 11, 7, 11) and KO mice with F10‐mock ( n = 9, 6, 9) and F10‐ Ccl21 ( n = 12, 5, 12) were measured. The average radiance of bioluminescence counts measured by IVIS Lumina system (p/s/cm 2 /sr) is shown. Orange lines show the median. Green dots show mild outliers. The data were analyzed by the Mann–Whitney U ‐test. * p < .05. (C) In vitro proliferation of B16‐F10‐derived cell lines stably transfected with the CCL21a expression or control plasmid. The cells were seeded in three wells at 1 × 10 3 cells/well, and the number of cells was counted on the indicated days. The graph shows the average values from three independent experiments. The significance test was performed by Student's t ‐test. Error bars indicate SEM. KO, knockout; WT, wild‐type.
    Mouse Anti Ccl21, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/baf457/Mouse+CCL21%2F6Ckine+Biotinylated+Antibody/pm35776111-115-75-77
    Average 92 stars, based on 1 article reviews
    mouse anti ccl21 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    CHS-induced dermal inflammation impairs DC entry into lymphatics in in vitro crawl-in assays but enhances their in vivo migration. (A) Current model of the different steps in DC migration from skin to dLNs and their documented dependence on CCL21 gradients. DCs approach dermal lymphatics migrating along a perilymphatic CCL21 gradient (1). Upon entry into lymphatic capillaries (i), DCs actively migrate in a semidirected manner, following the immobilized CCL21 gradient (2) deposited in the capillary lumen (ii). Once lymph flow picks up due to LV contractions in collectors, DCs are passively transported (iii) to the LN SCS. Egress from the SCS into the LN parenchyma (iv) occurs along another CCL21 gradient (3) (B and C) Crawl-in assay: Mice were sensitized with 2% oxazolone on the belly on day 0 and challenged on day 5 by applying 1% oxazolone to the skin of one ear. Crawl-in assays with both ears, i.e., the CTR and the CHS-inflamed ear, were performed 1 day later by adding fluorescently labelled LPS-matured WT and CCR7 −/− bone marrow–derived DCs (1:1 ratio) onto the dermal ear skin to allow DCs to migrate into lymphatics for 4 h. (B) Representative images of WT and CCR7 −/− bone marrow–derived DCs and the vasculature (stained for CD31) at the end of the experiment. Scale bar: 100 μm. (C) Quantification of the ratio of WT (left) and CCR7 −/− (right) bone marrow–derived DCs located inside vs. outside of lymphatics. n = 4 experiments performed with 1 mouse each. Paired Student’s t test. (D–H) In vivo DC migration assay: 1:1 mixture of LPS-matured and CCR7 −/− DCs, labelled in two fluorescent colors, were transferred into either CHS-inflamed or uninflamed CTR footpads. DC numbers in draining popliteal LNs were quantified by flow cytometry 16–18 h later. (D) Popliteal LN weight. (E) Popliteal LN cellularity. (F) Gating scheme used for the identification of transferred DCs. (G) Quantification of DC numbers in popliteal LNs. Pooled data from six experiments are shown (total n = 25 CTR and n = 25 CHS). (H) Ratio of migrated WT:CCR7 −/− DCs per experiment. Statistics: unpaired (D, E, and F) and paired (H—since in same animal) Student’s t test.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: CHS-induced dermal inflammation impairs DC entry into lymphatics in in vitro crawl-in assays but enhances their in vivo migration. (A) Current model of the different steps in DC migration from skin to dLNs and their documented dependence on CCL21 gradients. DCs approach dermal lymphatics migrating along a perilymphatic CCL21 gradient (1). Upon entry into lymphatic capillaries (i), DCs actively migrate in a semidirected manner, following the immobilized CCL21 gradient (2) deposited in the capillary lumen (ii). Once lymph flow picks up due to LV contractions in collectors, DCs are passively transported (iii) to the LN SCS. Egress from the SCS into the LN parenchyma (iv) occurs along another CCL21 gradient (3) (B and C) Crawl-in assay: Mice were sensitized with 2% oxazolone on the belly on day 0 and challenged on day 5 by applying 1% oxazolone to the skin of one ear. Crawl-in assays with both ears, i.e., the CTR and the CHS-inflamed ear, were performed 1 day later by adding fluorescently labelled LPS-matured WT and CCR7 −/− bone marrow–derived DCs (1:1 ratio) onto the dermal ear skin to allow DCs to migrate into lymphatics for 4 h. (B) Representative images of WT and CCR7 −/− bone marrow–derived DCs and the vasculature (stained for CD31) at the end of the experiment. Scale bar: 100 μm. (C) Quantification of the ratio of WT (left) and CCR7 −/− (right) bone marrow–derived DCs located inside vs. outside of lymphatics. n = 4 experiments performed with 1 mouse each. Paired Student’s t test. (D–H) In vivo DC migration assay: 1:1 mixture of LPS-matured and CCR7 −/− DCs, labelled in two fluorescent colors, were transferred into either CHS-inflamed or uninflamed CTR footpads. DC numbers in draining popliteal LNs were quantified by flow cytometry 16–18 h later. (D) Popliteal LN weight. (E) Popliteal LN cellularity. (F) Gating scheme used for the identification of transferred DCs. (G) Quantification of DC numbers in popliteal LNs. Pooled data from six experiments are shown (total n = 25 CTR and n = 25 CHS). (H) Ratio of migrated WT:CCR7 −/− DCs per experiment. Statistics: unpaired (D, E, and F) and paired (H—since in same animal) Student’s t test.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: In Vitro, In Vivo, Migration, Derivative Assay, Staining, Flow Cytometry

    The immobilized perilymphatic CCL21 gradient is diminished during CHS-induced skin inflammation. (A–E) Analysis of the immobilized perilymphatic CCL21 gradient stained in fresh (unfixed) CTR and CHS-inflamed ear skin (24 h after challenge). (A) Representative images showing the CCL21 and LYVE-1 signal at 20× magnification (scale bar: 50 μm). (B) Based on the LYVE-1 signal, a mask was generated to analyze the CCL21 intensity in relation to distance from the nearest LV. Scale bar: 100 μm. (C–E) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. CCL21 staining intensity was measured at (D) 0 μm or (E) 30 μm from the LV. n = 6 mice per condition (4–6 images analyzed per mouse). The dotted horizontal line in D and E indicates the level of background (isotype) staining. (F–H) Analysis of intracellular CCL21 deposits, revealed by staining in PFA-fixed CTR and CHS-inflamed ear skin. (F) Representative images. Scale bar: 50 μm. Quantification of G the intracellular CCL21 staining intensity and (H) the number of CCL21 deposits present within lymphatics. Pooled data from n = 4 mice/condition with 3–6 images/ear skin are shown. Data from the same experiment (i.e., same mouse) in G and H are connected by a line and analyzed by paired Student’s t test.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: The immobilized perilymphatic CCL21 gradient is diminished during CHS-induced skin inflammation. (A–E) Analysis of the immobilized perilymphatic CCL21 gradient stained in fresh (unfixed) CTR and CHS-inflamed ear skin (24 h after challenge). (A) Representative images showing the CCL21 and LYVE-1 signal at 20× magnification (scale bar: 50 μm). (B) Based on the LYVE-1 signal, a mask was generated to analyze the CCL21 intensity in relation to distance from the nearest LV. Scale bar: 100 μm. (C–E) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. CCL21 staining intensity was measured at (D) 0 μm or (E) 30 μm from the LV. n = 6 mice per condition (4–6 images analyzed per mouse). The dotted horizontal line in D and E indicates the level of background (isotype) staining. (F–H) Analysis of intracellular CCL21 deposits, revealed by staining in PFA-fixed CTR and CHS-inflamed ear skin. (F) Representative images. Scale bar: 50 μm. Quantification of G the intracellular CCL21 staining intensity and (H) the number of CCL21 deposits present within lymphatics. Pooled data from n = 4 mice/condition with 3–6 images/ear skin are shown. Data from the same experiment (i.e., same mouse) in G and H are connected by a line and analyzed by paired Student’s t test.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Staining, Generated

    A soluble proteoform of CCL21 (CCL21-ΔC) with chemotactic activity is present in murine skin and increased in CHS-inflamed skin. (A) Representative western blot of CCL21 performed on steady-state (CTR) and CHS-inflamed (CHS) murine ear skin protein extracts. Recombinant CCL21 was loaded as a CTR. (B) Western blot analysis of recombinant human full-length CCL21 and CCL21-ΔC protein. One out of two experiments is shown. (C) Quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentages. Pooled data from n = 4 independent biological replicates. (D) ELISA-based quantification of total CCL21 in tissue protein extracts, performed with antibody clone AF457, which detects full-length CCL21 and CCL21-ΔC. Pooled data from n = 5 mice/condition. Statistics: unpaired Student’s t test. (E–J) Skin elution assay and analyses were performed on the supernatants. (E) Schematic depiction of the assay and representative western blot analysis. (F) Image-based quantification of the CCL21-ΔC band intensity from western blots as in E. A.U., arbitrary units, as produced by the western blot imager (G) ELISA-based quantification of total CCL21, performed with antibody clone AF457. Pooled data from n = 6–7 mice/condition, with one CHS-inflamed and a contralateral CTR ear, are shown in E and F. Data from the same mouse are connected by a line. The mean is shown in red, paired Student’s t test. (H–J) Transwell chemotaxis assays were performed on elution assay supernatants (see E) with 1:1 mixtures of LPS-matured labelled WT and CCR7 −/− DCs in presence/absence of a CCL21-blocking antibody. Flow cytometry–based quantification of the total numbers of transmigrated (H) WT DCs and (I) CCR7 −/− DCs, as well as of (J) the ratio of transmigrated WT to CCR7 −/− DCs. Data points from 3–7 experiments per condition are shown. Mixed effects statistical analysis. (K) Ratio of WT: CCR7 −/− DCs measured in seven paired experiments performed for CTR and CHS-inflamed condition. Statistical analysis: paired Student's t test. (L and M) Western blot analysis of protein extracts of (L) steady-state human skin (CTR) and (M) donor-matched steady-state (CTR) and inflamed (INF) human skin from a psoriasis patient. Data from one out of two experiments in L and one experiment in M are shown. Recombinant human full-length CCL21 was loaded as a CTR. Source data are available for this figure: .

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: A soluble proteoform of CCL21 (CCL21-ΔC) with chemotactic activity is present in murine skin and increased in CHS-inflamed skin. (A) Representative western blot of CCL21 performed on steady-state (CTR) and CHS-inflamed (CHS) murine ear skin protein extracts. Recombinant CCL21 was loaded as a CTR. (B) Western blot analysis of recombinant human full-length CCL21 and CCL21-ΔC protein. One out of two experiments is shown. (C) Quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentages. Pooled data from n = 4 independent biological replicates. (D) ELISA-based quantification of total CCL21 in tissue protein extracts, performed with antibody clone AF457, which detects full-length CCL21 and CCL21-ΔC. Pooled data from n = 5 mice/condition. Statistics: unpaired Student’s t test. (E–J) Skin elution assay and analyses were performed on the supernatants. (E) Schematic depiction of the assay and representative western blot analysis. (F) Image-based quantification of the CCL21-ΔC band intensity from western blots as in E. A.U., arbitrary units, as produced by the western blot imager (G) ELISA-based quantification of total CCL21, performed with antibody clone AF457. Pooled data from n = 6–7 mice/condition, with one CHS-inflamed and a contralateral CTR ear, are shown in E and F. Data from the same mouse are connected by a line. The mean is shown in red, paired Student’s t test. (H–J) Transwell chemotaxis assays were performed on elution assay supernatants (see E) with 1:1 mixtures of LPS-matured labelled WT and CCR7 −/− DCs in presence/absence of a CCL21-blocking antibody. Flow cytometry–based quantification of the total numbers of transmigrated (H) WT DCs and (I) CCR7 −/− DCs, as well as of (J) the ratio of transmigrated WT to CCR7 −/− DCs. Data points from 3–7 experiments per condition are shown. Mixed effects statistical analysis. (K) Ratio of WT: CCR7 −/− DCs measured in seven paired experiments performed for CTR and CHS-inflamed condition. Statistical analysis: paired Student's t test. (L and M) Western blot analysis of protein extracts of (L) steady-state human skin (CTR) and (M) donor-matched steady-state (CTR) and inflamed (INF) human skin from a psoriasis patient. Data from one out of two experiments in L and one experiment in M are shown. Recombinant human full-length CCL21 was loaded as a CTR. Source data are available for this figure: .

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Activity Assay, Western Blot, Recombinant, Enzyme-linked Immunosorbent Assay, Produced, Chemotaxis Assay, Blocking Assay, Flow Cytometry

    In vitro assays demonstrating CCL21 cleavage by plasmin. (A and B) Western blot analysis of (A) human and (B) murine CCL21 cleavage after incubation with recombinant plasmin with a fixed molar ratio of 1:0.08 for increasing times at 37°C, as indicated in the figure. (C) Dose titration of the plasmin inhibitor C3 to a fixed molar ratio of murine CCL21:plasmin (1:0.08) and incubation for up to 4 h, as indicated in the figure. Representative western blots of n = 2 (A) or n = 3 (B and C) experiments are shown. (D) Fluorometric plasmin activation assay, with indicated plasmin (12 μM) and inhibitor concentrations. The % increase from T 0 (0 min) is depicted. PIC: broad spectrum protease inhibitor. Representative results of n = 3 independent experiments are shown. Source data are available for this figure: .

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: In vitro assays demonstrating CCL21 cleavage by plasmin. (A and B) Western blot analysis of (A) human and (B) murine CCL21 cleavage after incubation with recombinant plasmin with a fixed molar ratio of 1:0.08 for increasing times at 37°C, as indicated in the figure. (C) Dose titration of the plasmin inhibitor C3 to a fixed molar ratio of murine CCL21:plasmin (1:0.08) and incubation for up to 4 h, as indicated in the figure. Representative western blots of n = 2 (A) or n = 3 (B and C) experiments are shown. (D) Fluorometric plasmin activation assay, with indicated plasmin (12 μM) and inhibitor concentrations. The % increase from T 0 (0 min) is depicted. PIC: broad spectrum protease inhibitor. Representative results of n = 3 independent experiments are shown. Source data are available for this figure: .

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: In Vitro, Western Blot, Incubation, Recombinant, Titration, Activation Assay, Protease Inhibitor

    LECs activate plasminogen to plasmin, thereby generating CCL21-ΔC with enhanced chemotactic activity. (A and B) Quantification of (A) plasminogen and (B) plasmin activity in tissue protein extracts generated from CTR or CHS-inflamed ear skin. n = 6–7 mice per condition. (C) CTR experiment with CHS-inflamed ears documenting that the plasmin activity observed in C can be completely blocked in presence of the plasmin inhibitor C3. (D) Schematic depiction of the experimental hypothesis: Inflammation leads to enhanced extravasation of plasminogen. uPA bound to uPAR on CCL21-secreting LECs converts plasminogen to plasmin, thereby inducing CCL21 cleavage into CCL21-ΔC. (E–G) In vitro CCL21 cleavage experiment: (E) Schematic depiction of the experiment: immortalized LECs were incubated with recombinant CCL21 (100 nM) and plasminogen (20 nM) for 4 h or 24 h at 37°C in absence or presence of the plasmin inhibitor C3, mU1, or PIC. Supernatants were analyzed by western blot for CCL21. (F) Representative western blot of the cell culture supernatant at indicated time points and conditions and (G) quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentage. Pooled data from n = 4 independent experiments. Mean ± SEM, one-way ANOVA, and P values are relative to the “plg only” condition. (H and I) Cell culture supernatants generated as in E were evaluated in a 3D collagen migration assay. Recombinant human CCL21 and CCL21-ΔC were used as positive CTRs (H) Cell trajectory plots of migrating BMDCs’ migratory tracks in response to the stimuli applied on either side of the collagen channel. (I) Quantification of DC directionality, displacement, and velocity in response to the stimuli applied. Pooled data from n = 2 independent experiments with a total of n = 40–50 tracks analyzed per condition. Mean ± SEM, unpaired Student's t test for each comparison. (J–L) Analysis of the CCL21 cleavage activity of LECs isolated from uPA −/− mice or mice with defective uPA binding to uPAR (uPA mut ) (J) Schematic illustration of the three genotypes investigated. (K and L) Representative western blot of the cell culture supernatants after (K) 4 h and (L) 24 h of incubation (top) and quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentage (bottom). Pooled data from n = 5 independent experiments. Mean ± SEM, one-way ANOVA, and Source data are available for this figure: . plg, plasminogen.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: LECs activate plasminogen to plasmin, thereby generating CCL21-ΔC with enhanced chemotactic activity. (A and B) Quantification of (A) plasminogen and (B) plasmin activity in tissue protein extracts generated from CTR or CHS-inflamed ear skin. n = 6–7 mice per condition. (C) CTR experiment with CHS-inflamed ears documenting that the plasmin activity observed in C can be completely blocked in presence of the plasmin inhibitor C3. (D) Schematic depiction of the experimental hypothesis: Inflammation leads to enhanced extravasation of plasminogen. uPA bound to uPAR on CCL21-secreting LECs converts plasminogen to plasmin, thereby inducing CCL21 cleavage into CCL21-ΔC. (E–G) In vitro CCL21 cleavage experiment: (E) Schematic depiction of the experiment: immortalized LECs were incubated with recombinant CCL21 (100 nM) and plasminogen (20 nM) for 4 h or 24 h at 37°C in absence or presence of the plasmin inhibitor C3, mU1, or PIC. Supernatants were analyzed by western blot for CCL21. (F) Representative western blot of the cell culture supernatant at indicated time points and conditions and (G) quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentage. Pooled data from n = 4 independent experiments. Mean ± SEM, one-way ANOVA, and P values are relative to the “plg only” condition. (H and I) Cell culture supernatants generated as in E were evaluated in a 3D collagen migration assay. Recombinant human CCL21 and CCL21-ΔC were used as positive CTRs (H) Cell trajectory plots of migrating BMDCs’ migratory tracks in response to the stimuli applied on either side of the collagen channel. (I) Quantification of DC directionality, displacement, and velocity in response to the stimuli applied. Pooled data from n = 2 independent experiments with a total of n = 40–50 tracks analyzed per condition. Mean ± SEM, unpaired Student's t test for each comparison. (J–L) Analysis of the CCL21 cleavage activity of LECs isolated from uPA −/− mice or mice with defective uPA binding to uPAR (uPA mut ) (J) Schematic illustration of the three genotypes investigated. (K and L) Representative western blot of the cell culture supernatants after (K) 4 h and (L) 24 h of incubation (top) and quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentage (bottom). Pooled data from n = 5 independent experiments. Mean ± SEM, one-way ANOVA, and Source data are available for this figure: . plg, plasminogen.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Activity Assay, Generated, In Vitro, Incubation, Recombinant, Western Blot, Cell Culture, Migration, Comparison, Isolation, Binding Assay

    Expression of components of the plasmin activation pathway and CCL21 cleavage activity of cultured cells. (A and B) Flow cytometry–based analysis of uPA, uPAR, and plasminogen expression in conditionally immortalized LECs and primary LN LECs. (A) Representative histogram plots and corresponding (B) summary of the delta mean fluorescent intensity (ΔMFI; specific-isotype staining) values measured in 4–5 different experiments. (C) CCL21 cleavage assay performed in presence or absence of LECs and plasminogen (plg), revealing the dependence of CCL21 cleavage on both factors (i.e., LECs and plg). One representative out of two similar experiments is shown. (D and E) CCL21 cleavage assay performed with (D) bone marrow–derived DCs and (E) primary keratinocytes, revealing their ability to cleave CCL21 in presence of plg. One representative out of two similar experiments is shown in D and E. (F) qRT-PCR–based analysis of mRNA from LN LECs isolated from WT, uPA mut , and uPA −/− mice. (G) Absolute CT values and (H) relative expression levels. Data from four LN LEC isolations are shown. One-way ANOVA. (H and I) Impact of heparitinase treatment on the CCL21 gradient in uPA mut mice. (H) Representative images showing LYVE-1 and the immobilized perilymphatic CCL21 gradient in the steady-state ear skin of uPA mut mice upon in vitro treatment with heparitinase (HEP) or in untreated CTRs. Scale bar: 50 μm. (I) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. n = 3 mice per condition, two-way ANOVA. Source data are available for this figure: .

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Expression of components of the plasmin activation pathway and CCL21 cleavage activity of cultured cells. (A and B) Flow cytometry–based analysis of uPA, uPAR, and plasminogen expression in conditionally immortalized LECs and primary LN LECs. (A) Representative histogram plots and corresponding (B) summary of the delta mean fluorescent intensity (ΔMFI; specific-isotype staining) values measured in 4–5 different experiments. (C) CCL21 cleavage assay performed in presence or absence of LECs and plasminogen (plg), revealing the dependence of CCL21 cleavage on both factors (i.e., LECs and plg). One representative out of two similar experiments is shown. (D and E) CCL21 cleavage assay performed with (D) bone marrow–derived DCs and (E) primary keratinocytes, revealing their ability to cleave CCL21 in presence of plg. One representative out of two similar experiments is shown in D and E. (F) qRT-PCR–based analysis of mRNA from LN LECs isolated from WT, uPA mut , and uPA −/− mice. (G) Absolute CT values and (H) relative expression levels. Data from four LN LEC isolations are shown. One-way ANOVA. (H and I) Impact of heparitinase treatment on the CCL21 gradient in uPA mut mice. (H) Representative images showing LYVE-1 and the immobilized perilymphatic CCL21 gradient in the steady-state ear skin of uPA mut mice upon in vitro treatment with heparitinase (HEP) or in untreated CTRs. Scale bar: 50 μm. (I) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. n = 3 mice per condition, two-way ANOVA. Source data are available for this figure: .

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Expressing, Activation Assay, Activity Assay, Cell Culture, Flow Cytometry, Staining, Cleavage Assay, Derivative Assay, Quantitative RT-PCR, Isolation, In Vitro

    Video showing fluorescently labeled bone marrow–derived DCs (green) moving in 3D collagen toward recombinant human CCL21 (up) and CCL21+plg (down) provided in reservoirs on left and right, respectively, of the chamber. WT DCs display enhanced migration toward CCL21-ΔC provided on the left. Video specifications: 5-min intervals; 5 frames/s (1500-fold accelerated). The original length of the recording: 200 min. Video length: 8 s. plg, plasminogen.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Video showing fluorescently labeled bone marrow–derived DCs (green) moving in 3D collagen toward recombinant human CCL21 (up) and CCL21+plg (down) provided in reservoirs on left and right, respectively, of the chamber. WT DCs display enhanced migration toward CCL21-ΔC provided on the left. Video specifications: 5-min intervals; 5 frames/s (1500-fold accelerated). The original length of the recording: 200 min. Video length: 8 s. plg, plasminogen.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Labeling, Derivative Assay, Recombinant, Migration

    Impact of plasmin and plasmin(ogen) on in vitro DC migration. In vitro experiments were performed with LPS-matured bone marrow–derived DCs and primary LN LECs. (A) DC displayed greater chemotaxis toward CCL21-ΔC as compared with full-length CCL21. (B) DCs were allowed to transmigrate for 4 h across primary LN LEC monolayers. DCs displayed a near-significant in transmigration (i.e., in two out of three experiments) toward CCL21-ΔC compared with CCL21 added to the lower well compartment. (C and D) The presence of plasminogen (Plg) or plasmin (Plm), which were added to the upper and lower wells of the Transwell plate, did not impact DC chemotaxis toward (C) CCL21-ΔC and (D) CXCL12. Each data point represents an independent experiment. (E and F) The presence of plasminogen or plasmin in the assay (upper and lower wells) did not impact DC transmigration across LEC monolayers toward (E) CCL21-ΔC or (F) CXCL12. Each data point represents an independent experiment. (G and H) Crawling assay: YFP-expressing DCs were added on top of LEC monolayers, and their migration was recorded by time-lapse microscopy. The presence of plasminogen or plasmin in the medium did not impact the (G) velocity and (H) chemotactic index of DC crawling. Of note: Inhibition of ROCK with Y27632 was performed as positive CTR . Statistics: two-way ANOVA using multiple comparisons, followed by a Tukey correction. (I) qPCR-results demonstrating that in vitro –cultured primary LN LECs no longer express CCL21 and also do not express CCL19. S18: housekeeping gene; gp38: podoplanin. Raw CT values are shown. n = 3 different biological replicates (isolations).

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Impact of plasmin and plasmin(ogen) on in vitro DC migration. In vitro experiments were performed with LPS-matured bone marrow–derived DCs and primary LN LECs. (A) DC displayed greater chemotaxis toward CCL21-ΔC as compared with full-length CCL21. (B) DCs were allowed to transmigrate for 4 h across primary LN LEC monolayers. DCs displayed a near-significant in transmigration (i.e., in two out of three experiments) toward CCL21-ΔC compared with CCL21 added to the lower well compartment. (C and D) The presence of plasminogen (Plg) or plasmin (Plm), which were added to the upper and lower wells of the Transwell plate, did not impact DC chemotaxis toward (C) CCL21-ΔC and (D) CXCL12. Each data point represents an independent experiment. (E and F) The presence of plasminogen or plasmin in the assay (upper and lower wells) did not impact DC transmigration across LEC monolayers toward (E) CCL21-ΔC or (F) CXCL12. Each data point represents an independent experiment. (G and H) Crawling assay: YFP-expressing DCs were added on top of LEC monolayers, and their migration was recorded by time-lapse microscopy. The presence of plasminogen or plasmin in the medium did not impact the (G) velocity and (H) chemotactic index of DC crawling. Of note: Inhibition of ROCK with Y27632 was performed as positive CTR . Statistics: two-way ANOVA using multiple comparisons, followed by a Tukey correction. (I) qPCR-results demonstrating that in vitro –cultured primary LN LECs no longer express CCL21 and also do not express CCL19. S18: housekeeping gene; gp38: podoplanin. Raw CT values are shown. n = 3 different biological replicates (isolations).

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: In Vitro, Migration, Derivative Assay, Chemotaxis Assay, Transmigration Assay, Expressing, Time-lapse Microscopy, Inhibition, Cell Culture

    The immobilized perilymphatic CCL21 gradient is diminished during TPA-induced skin inflammation. The skin of one ear of each mouse was inflamed by topical application of the irritant TPA. Experiments with both ears, i.e., the uninflamed (CTR and the TPA-inflamed ear, were performed 1 day later. (A–D) Analysis of the extracellular, immobilized perilymphatic CCL21 gradient stained in fresh (unfixed) CTR and TPA-inflamed ear skin. (A) Representative images showing the CCL21 and LYVE-1 signal at 20× magnification (scale bar: 50 μm). (B) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. CCL21 staining intensity was measured at (C) 0 μm or (D) 30 μm from the LV. n = 3 mice per condition (4–6 images analyzed per mouse). The dotted horizontal line in C and D indicates the level of background (isotype) staining. (E) Elution assay: CTR and TPA-inflamed ear skin were placed in medium overnight, and the amount of CCL21 protein eluted into the medium was determined by ELISA. (F and G) Quantification of (F) plasminogen and (G) plasmin activity in tissue protein extracts generated from CTR or TPA-inflamed ear skin. n = 6–7 mice per condition. All graphs: unpaired Student’s t test.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: The immobilized perilymphatic CCL21 gradient is diminished during TPA-induced skin inflammation. The skin of one ear of each mouse was inflamed by topical application of the irritant TPA. Experiments with both ears, i.e., the uninflamed (CTR and the TPA-inflamed ear, were performed 1 day later. (A–D) Analysis of the extracellular, immobilized perilymphatic CCL21 gradient stained in fresh (unfixed) CTR and TPA-inflamed ear skin. (A) Representative images showing the CCL21 and LYVE-1 signal at 20× magnification (scale bar: 50 μm). (B) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. CCL21 staining intensity was measured at (C) 0 μm or (D) 30 μm from the LV. n = 3 mice per condition (4–6 images analyzed per mouse). The dotted horizontal line in C and D indicates the level of background (isotype) staining. (E) Elution assay: CTR and TPA-inflamed ear skin were placed in medium overnight, and the amount of CCL21 protein eluted into the medium was determined by ELISA. (F and G) Quantification of (F) plasminogen and (G) plasmin activity in tissue protein extracts generated from CTR or TPA-inflamed ear skin. n = 6–7 mice per condition. All graphs: unpaired Student’s t test.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Staining, Enzyme-linked Immunosorbent Assay, Activity Assay, Generated

    Blockade of uPA or plasmin activity alters the perilymphatic CCL21 gradient. (A) Representative images showing LYVE-1 and the immobilized perilymphatic CCL21 gradient in the steady-state ear skin of WT, uPA mut and uPA −/− , ACKR4 −/− , and CCR7 −/− mice. Scale bar: 50 μm. (B) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. n = 4–6 mice per condition, two-way ANOVA (C and D) Quantification of the CCL21 staining intensity at (C) 0 μm or 30 μm from the LV. (E) Ratio of the CCL21 signal intensity measured at 60 vs. 0 μm from the LV. n = 4–6 mice per condition; one-way ANOVA. (F) ELISA-based quantification of total CCL21 in culture supernatants from ear skin of WT and uPA mut mice, performed with antibody clone AF457 which detects full-length CCL21 and CCL21-ΔC. Pooled data from n = 4 mice/condition. Statistics: unpaired Student's t test. (G–J) Impact of 24 h of combined treatment with the plasmin-selective inhibitor C3 and uPA-blocking antibody mU1 on the perilymphatic CCL21 gradient. (G) Representative images showing the CCL21 and LYVE-1 signal in the ear skin of mice. Scale bar: 50 μm. (H) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. Two-way ANOVA, n = 3 mice. (I and J) Quantification of the CCL21 staining intensity at (I) 0 μm or (J) 30 μm from the LV. n = 3 mice per condition. Paired Student’s t test.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Blockade of uPA or plasmin activity alters the perilymphatic CCL21 gradient. (A) Representative images showing LYVE-1 and the immobilized perilymphatic CCL21 gradient in the steady-state ear skin of WT, uPA mut and uPA −/− , ACKR4 −/− , and CCR7 −/− mice. Scale bar: 50 μm. (B) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. n = 4–6 mice per condition, two-way ANOVA (C and D) Quantification of the CCL21 staining intensity at (C) 0 μm or 30 μm from the LV. (E) Ratio of the CCL21 signal intensity measured at 60 vs. 0 μm from the LV. n = 4–6 mice per condition; one-way ANOVA. (F) ELISA-based quantification of total CCL21 in culture supernatants from ear skin of WT and uPA mut mice, performed with antibody clone AF457 which detects full-length CCL21 and CCL21-ΔC. Pooled data from n = 4 mice/condition. Statistics: unpaired Student's t test. (G–J) Impact of 24 h of combined treatment with the plasmin-selective inhibitor C3 and uPA-blocking antibody mU1 on the perilymphatic CCL21 gradient. (G) Representative images showing the CCL21 and LYVE-1 signal in the ear skin of mice. Scale bar: 50 μm. (H) Quantification of the CCL21 staining intensity as a function of the distance from the nearest LYVE-1 + LV. Two-way ANOVA, n = 3 mice. (I and J) Quantification of the CCL21 staining intensity at (I) 0 μm or (J) 30 μm from the LV. n = 3 mice per condition. Paired Student’s t test.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Activity Assay, Staining, Enzyme-linked Immunosorbent Assay, Blocking Assay

    Blockade of uPA results in reduced CCL21-ΔC levels in skin-dLNs. (A and B) Western blot–based comparison of CCL21 proteoforms in steady-state LNs and ear skin. (A) Representative western blots performed on tissue protein extracts and (B) and quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentages. Pooled data from n = 4 western blots from independent experiments. (C) Representative western blot of CCL21 performed on LN extracts, LN eluates, and serum. (D) ELISA-based quantification of full-length CCL21 and CCL21-ΔC present in LN extracts, LN eluates, or serum. Antibody clone MAB457 detects full-length CCL21 only, whereas clone AF457 detects both full-length CCL21 and CCL21-ΔC. Data from n = 3 mice are shown. n.d., not detected. (E) ELISA-based quantification of full-length CCL21 and CCL21-ΔC present in LN eluates from WT and uPA mut mice. Data from n = 4–5 mice are shown, Student’s t test. n.d., not detected. (F and G) Protein extracts were prepared from LNs of PBS-perfused WT and uPA mut mice and used for ELISA-based quantification of (F) plasminogen and (G) assessment of plasmin activity (colorimetric assay). Pooled data from n = 6 mice per group are shown as mean ± SEM. Student’s t test. (H and I) Analysis of CCL21 levels in LNs of WT and uPA mut mice. Freshly cut LN sections were immediately (i.e., without fixation/permeabilization) stained for B220 (B cell follicles), LYVE-1, and CCL21. Images were subjected to AI-based tissue segmentation for differentiating between the T cell zone and B cell follicles/SCS. (H) Representative images from the immunofluorescent staining performed on LNs of WT and uPA mut mice. Scale bar: 100 μm. (I) Quantification of CCL21 staining intensity observed in the T cell zone. Each dot represents data from a stained auricular LN of one mouse (average of 4–6 images per LN). Student’s t test. Source data are available for this figure: .

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Blockade of uPA results in reduced CCL21-ΔC levels in skin-dLNs. (A and B) Western blot–based comparison of CCL21 proteoforms in steady-state LNs and ear skin. (A) Representative western blots performed on tissue protein extracts and (B) and quantification of the full-length CCL21 (gray) and CCL21-ΔC (white) relative band percentages. Pooled data from n = 4 western blots from independent experiments. (C) Representative western blot of CCL21 performed on LN extracts, LN eluates, and serum. (D) ELISA-based quantification of full-length CCL21 and CCL21-ΔC present in LN extracts, LN eluates, or serum. Antibody clone MAB457 detects full-length CCL21 only, whereas clone AF457 detects both full-length CCL21 and CCL21-ΔC. Data from n = 3 mice are shown. n.d., not detected. (E) ELISA-based quantification of full-length CCL21 and CCL21-ΔC present in LN eluates from WT and uPA mut mice. Data from n = 4–5 mice are shown, Student’s t test. n.d., not detected. (F and G) Protein extracts were prepared from LNs of PBS-perfused WT and uPA mut mice and used for ELISA-based quantification of (F) plasminogen and (G) assessment of plasmin activity (colorimetric assay). Pooled data from n = 6 mice per group are shown as mean ± SEM. Student’s t test. (H and I) Analysis of CCL21 levels in LNs of WT and uPA mut mice. Freshly cut LN sections were immediately (i.e., without fixation/permeabilization) stained for B220 (B cell follicles), LYVE-1, and CCL21. Images were subjected to AI-based tissue segmentation for differentiating between the T cell zone and B cell follicles/SCS. (H) Representative images from the immunofluorescent staining performed on LNs of WT and uPA mut mice. Scale bar: 100 μm. (I) Quantification of CCL21 staining intensity observed in the T cell zone. Each dot represents data from a stained auricular LN of one mouse (average of 4–6 images per LN). Student’s t test. Source data are available for this figure: .

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Western Blot, Comparison, Enzyme-linked Immunosorbent Assay, Activity Assay, Colorimetric Assay, Staining

    Supplemental data to FITC painting experiments and analysis of LNs draining CHS-inflamed skin. (A) Schematic depiction of the experiment: FITC was applied to the ear skin in WT and uPA mut mice, and ear skin or ear-draining auricular LNs were collected for analysis after 24 h. (B and C) Analysis of dermal DC numbers. Ear skin was enzymatically digested, and single-cell suspensions were generated for flow cytometry–based analysis. (D and E) Gatings used to identify migratory DCs (CD11c + MHCII hi ), and, amongst those, FITC + DCs in single-cell suspensions generated from (D) enzymatically digested LNs and (E) undigested LNs. (F–I) Analysis of immobilized CCL21 and plasmin(ogen) in CHS-dLNs. A CHS response was induced in the ear skin of WT mice, and ear-draining auricular LNs were collected 24 h later. (F and G) Analysis of CCL21 levels in LNs draining CTR or CHS-inflamed ear skin. Freshly cut LN sections were immediately (i.e., without fixation/permeabilization) stained for B220 (B cell follicles), LYVE-1, and CCL21. (F) Representative images of the immunofluorescent staining and of the AI-based tissue segmentation used for differentiating between the T cell zone and B cell follicles/SCS. Scale bar: 100 μm. (G) Quantification of CCL21 staining intensity of observed in the T cell zone. Each dot represents data from a stained auricular LN of one mouse (average of 4–6 images per LN). Student’s t test. (H) ELISA-based quantification of (H) plasminogen and (I) plasmin activity in LN protein extracts, generated after perfusing the mice with PBS. Pooled data from n = 6 mice per group are shown in H and I, Student’s t test. (J) Representative gating strategy used for the quantification of FITC + CD11c + cells in LN sections from WT and uPA mut FITC-painted auricular LNs in . CD11c + cells were identified based on CD11c-AF647 positivity. From the CD11c + population, FITC + cells were identified and subsequently quantified. Marker-negative cells (red color) served as negative control to check background staining and to set the fluorescence thresholds. Please note that the data points of the WT CTR group in C are identical to those shown in , as these extracts were prepared and measured simultaneously.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Supplemental data to FITC painting experiments and analysis of LNs draining CHS-inflamed skin. (A) Schematic depiction of the experiment: FITC was applied to the ear skin in WT and uPA mut mice, and ear skin or ear-draining auricular LNs were collected for analysis after 24 h. (B and C) Analysis of dermal DC numbers. Ear skin was enzymatically digested, and single-cell suspensions were generated for flow cytometry–based analysis. (D and E) Gatings used to identify migratory DCs (CD11c + MHCII hi ), and, amongst those, FITC + DCs in single-cell suspensions generated from (D) enzymatically digested LNs and (E) undigested LNs. (F–I) Analysis of immobilized CCL21 and plasmin(ogen) in CHS-dLNs. A CHS response was induced in the ear skin of WT mice, and ear-draining auricular LNs were collected 24 h later. (F and G) Analysis of CCL21 levels in LNs draining CTR or CHS-inflamed ear skin. Freshly cut LN sections were immediately (i.e., without fixation/permeabilization) stained for B220 (B cell follicles), LYVE-1, and CCL21. (F) Representative images of the immunofluorescent staining and of the AI-based tissue segmentation used for differentiating between the T cell zone and B cell follicles/SCS. Scale bar: 100 μm. (G) Quantification of CCL21 staining intensity of observed in the T cell zone. Each dot represents data from a stained auricular LN of one mouse (average of 4–6 images per LN). Student’s t test. (H) ELISA-based quantification of (H) plasminogen and (I) plasmin activity in LN protein extracts, generated after perfusing the mice with PBS. Pooled data from n = 6 mice per group are shown in H and I, Student’s t test. (J) Representative gating strategy used for the quantification of FITC + CD11c + cells in LN sections from WT and uPA mut FITC-painted auricular LNs in . CD11c + cells were identified based on CD11c-AF647 positivity. From the CD11c + population, FITC + cells were identified and subsequently quantified. Marker-negative cells (red color) served as negative control to check background staining and to set the fluorescence thresholds. Please note that the data points of the WT CTR group in C are identical to those shown in , as these extracts were prepared and measured simultaneously.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Generated, Flow Cytometry, Staining, Enzyme-linked Immunosorbent Assay, Activity Assay, Marker, Negative Control, Fluorescence

    Summary diagram. Summary of the main findings and the overall model. Top: Summary of events happening at the level of LECs: continuous low-level extravasation of plasminogen from blood vessels leads to uPA/uPAR-mediated activation of plasmin, which in turn cleaves immobilized CCL21 into soluble CCL21-ΔC (WT steady-state—left). When uPA-mediated activation of plasminogen is compromised (uPA mut ), less CCL21 gets cleaved, shifting the balance toward more immobilized CCL21 accumulating on/around LECs (uPA mut steady-state—middle). Under inflammatory conditions, with higher extravasation of plasminogen and higher expression of uPA and uPAR by LECs, more plasmin is activated, resulting in more CCL21 cleavage (WT inflammation—right). Bottom: The bottom part of the figure illustrates how these changes affect the balance between immobilized CCL21 and soluble CCL21-ΔC around afferent lymphatics and in the dLN. Additionally, the impact on distinct CCR7-dependent steps (1–3) in lymphatic migration of DCs are indicated. Question marks (?) indicate steps that were not specifically investigated in this study and thus represent speculations based on indirect findings and/or the literature.

    Journal: The Journal of Cell Biology

    Article Title: uPA-mediated remodeling of CCL21 gradients regulates lymphatic migration of dendritic cells

    doi: 10.1083/jcb.202412190

    Figure Lengend Snippet: Summary diagram. Summary of the main findings and the overall model. Top: Summary of events happening at the level of LECs: continuous low-level extravasation of plasminogen from blood vessels leads to uPA/uPAR-mediated activation of plasmin, which in turn cleaves immobilized CCL21 into soluble CCL21-ΔC (WT steady-state—left). When uPA-mediated activation of plasminogen is compromised (uPA mut ), less CCL21 gets cleaved, shifting the balance toward more immobilized CCL21 accumulating on/around LECs (uPA mut steady-state—middle). Under inflammatory conditions, with higher extravasation of plasminogen and higher expression of uPA and uPAR by LECs, more plasmin is activated, resulting in more CCL21 cleavage (WT inflammation—right). Bottom: The bottom part of the figure illustrates how these changes affect the balance between immobilized CCL21 and soluble CCL21-ΔC around afferent lymphatics and in the dLN. Additionally, the impact on distinct CCR7-dependent steps (1–3) in lymphatic migration of DCs are indicated. Question marks (?) indicate steps that were not specifically investigated in this study and thus represent speculations based on indirect findings and/or the literature.

    Article Snippet: Fresh dorsal ear sheets were incubated for 2 h in 1 ml 0.1% BSA in PBS before adding the following primary antibodies in 0.5 ml 0.1% BSA in PBS overnight at 4°C: rabbit-anti-mouse LYVE-1 (polyclonal, AngioBio), rat-anti-mouse CD31 (clone MEC 13.3; BD Pharmingen), and goat-anti-mouse CCL21 (polyclonal, R&D Systems).

    Techniques: Activation Assay, Expressing, Migration

    KEY RESOURCES TABLE

    Journal: Cell

    Article Title: Inflammation switches the chemoattractant requirements for naive lymphocyte entry into lymph nodes

    doi: 10.1016/j.cell.2024.11.031

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Goat Anti-Mouse Ccl21 / 6ckine Polyclonal antibody, Biotin Conjugated , R and D Systems , Cat# BAF457; RRID:AB_2072082.

    Techniques: Control, Virus, Recombinant, Adjuvant, Reverse Transcription, RNAscope, SYBR Green Assay, Plasmid Preparation, Software

    The host‐ and melanoma cell‐derived CCL21‐Ser expression contributes to tumor growth in WT control and the Ccl21a ‐KO mice. (A) Tumors were weighed 2 weeks after injection with cells derived from F10‐mock (WT; n = 47, KO; n = 41) and F10‐ccl21 (WT; n = 54, KO; n = 45). Each plot shows an individual tumor. The data were analyzed by the Steel–Dwass test. Orange lines show the median. * p < 0.05, NS, not significant. (B) F10‐mock and F10‐ccl21 cells stably expressing click beetle luciferase were established and subcutaneously injected into WT or Ccl21a ‐KO on the B6 Albino background. Bioluminescence on Days 7, 10, and 14 of wild‐type mice with F10‐mock ( n = 10, 6, 10) and F10‐ Ccl21 ( n = 11, 7, 11) and KO mice with F10‐mock ( n = 9, 6, 9) and F10‐ Ccl21 ( n = 12, 5, 12) were measured. The average radiance of bioluminescence counts measured by IVIS Lumina system (p/s/cm 2 /sr) is shown. Orange lines show the median. Green dots show mild outliers. The data were analyzed by the Mann–Whitney U ‐test. * p < .05. (C) In vitro proliferation of B16‐F10‐derived cell lines stably transfected with the CCL21a expression or control plasmid. The cells were seeded in three wells at 1 × 10 3 cells/well, and the number of cells was counted on the indicated days. The graph shows the average values from three independent experiments. The significance test was performed by Student's t ‐test. Error bars indicate SEM. KO, knockout; WT, wild‐type.

    Journal: Cancer Science

    Article Title: CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth

    doi: 10.1111/cas.15902

    Figure Lengend Snippet: The host‐ and melanoma cell‐derived CCL21‐Ser expression contributes to tumor growth in WT control and the Ccl21a ‐KO mice. (A) Tumors were weighed 2 weeks after injection with cells derived from F10‐mock (WT; n = 47, KO; n = 41) and F10‐ccl21 (WT; n = 54, KO; n = 45). Each plot shows an individual tumor. The data were analyzed by the Steel–Dwass test. Orange lines show the median. * p < 0.05, NS, not significant. (B) F10‐mock and F10‐ccl21 cells stably expressing click beetle luciferase were established and subcutaneously injected into WT or Ccl21a ‐KO on the B6 Albino background. Bioluminescence on Days 7, 10, and 14 of wild‐type mice with F10‐mock ( n = 10, 6, 10) and F10‐ Ccl21 ( n = 11, 7, 11) and KO mice with F10‐mock ( n = 9, 6, 9) and F10‐ Ccl21 ( n = 12, 5, 12) were measured. The average radiance of bioluminescence counts measured by IVIS Lumina system (p/s/cm 2 /sr) is shown. Orange lines show the median. Green dots show mild outliers. The data were analyzed by the Mann–Whitney U ‐test. * p < .05. (C) In vitro proliferation of B16‐F10‐derived cell lines stably transfected with the CCL21a expression or control plasmid. The cells were seeded in three wells at 1 × 10 3 cells/well, and the number of cells was counted on the indicated days. The graph shows the average values from three independent experiments. The significance test was performed by Student's t ‐test. Error bars indicate SEM. KO, knockout; WT, wild‐type.

    Article Snippet: The cell culture supernatant was diluted 100‐fold with PBST (0.1% PBS containing 0.05% Tween20), added dropwise to a 96‐well microplate, and immobilized for 2 h. The wells were treated with 200 ng/mL biotinylated anti‐mouse CCL21 antibody (BAF457, R&D Systems) for 1 h. After washing five times with PBST, the wells were treated with HRP‐conjugated streptavidin (1:5000 dilution with PBST containing 0.1% BSA, Perkin Elmer) for 1 h. Absorbance at 650 nm was measured using a MultiScan spectrophotometer (Thermo Fisher Scientific) 15 min after the addition of SureBlue tetramethylbenzidine (TMB) peroxidase Substrate (SeraCare Life Sciences).

    Techniques: Derivative Assay, Expressing, Control, Injection, Stable Transfection, Luciferase, MANN-WHITNEY, In Vitro, Transfection, Plasmid Preparation, Knock-Out

    T lymphocyte infiltration is increased in tumors of Ccl21a ‐KO mice. Tumors derived from F10‐mock (WT; n = 8, KO; n = 9) and F10‐ccl21 (WT; n = 12, KO; n = 13) were dissected 2 weeks after cell injection, and intratumoral immune cell subsets were analyzed by flow cytometry. The intratumoral CD3 + cell subset was distinguished by the CD45 expression, side scatter profiles, and CD3 expression, and the CD3 + T count per tumor weight is shown (A). The intratumoral CD4 + (B) and CD8 + (C) subset was distinguished by the FSC/SSC profile of tumor cells and CD4 and CD8 expression. (D) Tumor‐infiltrated CD4 + CD25 + CD127 lo Tregs in B16‐F10‐derived tumors in WT and Ccl21a ‐KO mice were analyzed. The plot represents individual tumor samples obtained from three or four experimental repeats with two to four mice in each group. Tumor cells derived from F10‐mock tumor (WT; n = 10, KO; n = 10) and F10‐ccl21 tumor (WT; n = 11, KO; n = 9) were analyzed. The count of (E) myeloid‐derived suppressor cells (MDSCs) (Gr‐1 + CD11b + ), (F) macrophage (F4/80 + ), and (G) dendritic cells (DCs) (F4/80 − MHC class II + CD11c + ) in an individual tumor sample in WT and Ccl21a ‐KO mice. Tumor cells derived from F10‐mock tumor (WT; n = 10, KO; n = 10) and F10‐ccl21 tumor (WT; n = 9, KO; n = 6) were analyzed. The plot represents individual tumor samples obtained from three or four experimental repeats with two to four mice in each group. The data were analyzed using the Kruskal–Wallis test with the Steel–Dwass post‐hoc test. Orange lines show the median. * p < 0.05, ** p < .01, NS, not significant. KO, knockout; WT, wild‐type.

    Journal: Cancer Science

    Article Title: CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth

    doi: 10.1111/cas.15902

    Figure Lengend Snippet: T lymphocyte infiltration is increased in tumors of Ccl21a ‐KO mice. Tumors derived from F10‐mock (WT; n = 8, KO; n = 9) and F10‐ccl21 (WT; n = 12, KO; n = 13) were dissected 2 weeks after cell injection, and intratumoral immune cell subsets were analyzed by flow cytometry. The intratumoral CD3 + cell subset was distinguished by the CD45 expression, side scatter profiles, and CD3 expression, and the CD3 + T count per tumor weight is shown (A). The intratumoral CD4 + (B) and CD8 + (C) subset was distinguished by the FSC/SSC profile of tumor cells and CD4 and CD8 expression. (D) Tumor‐infiltrated CD4 + CD25 + CD127 lo Tregs in B16‐F10‐derived tumors in WT and Ccl21a ‐KO mice were analyzed. The plot represents individual tumor samples obtained from three or four experimental repeats with two to four mice in each group. Tumor cells derived from F10‐mock tumor (WT; n = 10, KO; n = 10) and F10‐ccl21 tumor (WT; n = 11, KO; n = 9) were analyzed. The count of (E) myeloid‐derived suppressor cells (MDSCs) (Gr‐1 + CD11b + ), (F) macrophage (F4/80 + ), and (G) dendritic cells (DCs) (F4/80 − MHC class II + CD11c + ) in an individual tumor sample in WT and Ccl21a ‐KO mice. Tumor cells derived from F10‐mock tumor (WT; n = 10, KO; n = 10) and F10‐ccl21 tumor (WT; n = 9, KO; n = 6) were analyzed. The plot represents individual tumor samples obtained from three or four experimental repeats with two to four mice in each group. The data were analyzed using the Kruskal–Wallis test with the Steel–Dwass post‐hoc test. Orange lines show the median. * p < 0.05, ** p < .01, NS, not significant. KO, knockout; WT, wild‐type.

    Article Snippet: The cell culture supernatant was diluted 100‐fold with PBST (0.1% PBS containing 0.05% Tween20), added dropwise to a 96‐well microplate, and immobilized for 2 h. The wells were treated with 200 ng/mL biotinylated anti‐mouse CCL21 antibody (BAF457, R&D Systems) for 1 h. After washing five times with PBST, the wells were treated with HRP‐conjugated streptavidin (1:5000 dilution with PBST containing 0.1% BSA, Perkin Elmer) for 1 h. Absorbance at 650 nm was measured using a MultiScan spectrophotometer (Thermo Fisher Scientific) 15 min after the addition of SureBlue tetramethylbenzidine (TMB) peroxidase Substrate (SeraCare Life Sciences).

    Techniques: Derivative Assay, Injection, Flow Cytometry, Expressing, Knock-Out

    Expression of Ccl21a increases naïve T cell frequency and reduces the CD8/CD4 ratio of intratumoral T cells. Intratumoral T cells of F10‐mock (WT; n = 14, KO; n = 13) and F10‐ccl21 (WT; n = 14, KO; n = 15) tumors were analyzed by flow cytometry. (A) Proportion of CD3 + T cells and CD8/CD4 ratio, (B, C) naïve (CD44 − CD62L + ), activated (CD44 + CD62L − ) CD4 + and CD8 + cells, IFN‐γ + CD8 + cells, (D–G) Tregs, myeloid‐derived suppressor cells (MDSCs), macrophages, and dendritic cells (DCs) of the CD45 + hematopoietic cells in F10‐mock (WT; n = 12, KO; n = 9) and F10‐ccl21 (WT; n = 11, KO; n = 12) tumors. The plot represents individual tumor samples obtained from three to five experimental repeats with one to four mice in each group. The data were analyzed using the Kruskal–Wallis test with the Steel–Dwass post‐hoc test. Orange lines show the median. * p < 0.05, ** p < 0.01, *** p < 0.001. NS, not significant. KO, knockout; WT, wild‐type.

    Journal: Cancer Science

    Article Title: CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth

    doi: 10.1111/cas.15902

    Figure Lengend Snippet: Expression of Ccl21a increases naïve T cell frequency and reduces the CD8/CD4 ratio of intratumoral T cells. Intratumoral T cells of F10‐mock (WT; n = 14, KO; n = 13) and F10‐ccl21 (WT; n = 14, KO; n = 15) tumors were analyzed by flow cytometry. (A) Proportion of CD3 + T cells and CD8/CD4 ratio, (B, C) naïve (CD44 − CD62L + ), activated (CD44 + CD62L − ) CD4 + and CD8 + cells, IFN‐γ + CD8 + cells, (D–G) Tregs, myeloid‐derived suppressor cells (MDSCs), macrophages, and dendritic cells (DCs) of the CD45 + hematopoietic cells in F10‐mock (WT; n = 12, KO; n = 9) and F10‐ccl21 (WT; n = 11, KO; n = 12) tumors. The plot represents individual tumor samples obtained from three to five experimental repeats with one to four mice in each group. The data were analyzed using the Kruskal–Wallis test with the Steel–Dwass post‐hoc test. Orange lines show the median. * p < 0.05, ** p < 0.01, *** p < 0.001. NS, not significant. KO, knockout; WT, wild‐type.

    Article Snippet: The cell culture supernatant was diluted 100‐fold with PBST (0.1% PBS containing 0.05% Tween20), added dropwise to a 96‐well microplate, and immobilized for 2 h. The wells were treated with 200 ng/mL biotinylated anti‐mouse CCL21 antibody (BAF457, R&D Systems) for 1 h. After washing five times with PBST, the wells were treated with HRP‐conjugated streptavidin (1:5000 dilution with PBST containing 0.1% BSA, Perkin Elmer) for 1 h. Absorbance at 650 nm was measured using a MultiScan spectrophotometer (Thermo Fisher Scientific) 15 min after the addition of SureBlue tetramethylbenzidine (TMB) peroxidase Substrate (SeraCare Life Sciences).

    Techniques: Expressing, Flow Cytometry, Derivative Assay, Knock-Out

    Expression of Ccl21a increases the frequency of intratumoral CCR7 + cells. (A) The intratumoral hematopoietic cells were distinguished by the CD45 expression and side scatter profiles (top), and the number of CCR7 + cells per tumor weight (bottom) is shown. (B) The percentage of CD45 + hematopoietic cells and CCR7 + cells of CD45 + cells is shown. Tumor cells derived from F10‐mock (WT; n = 8, KO; n = 9) and F10‐ccl21 (WT; n = 12, KO; n = 13) were analyzed. The plot represents individual tumor samples obtained from three to five experimental repeats with two to four mice in each group. The data were analyzed using the Kruskal–Wallis test with the Steel–Dwass post‐hoc test. Orange lines show the median. * p < 0.05, *** p < 0.001. NS, not significant. KO, knockout; WT, wild‐type.

    Journal: Cancer Science

    Article Title: CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth

    doi: 10.1111/cas.15902

    Figure Lengend Snippet: Expression of Ccl21a increases the frequency of intratumoral CCR7 + cells. (A) The intratumoral hematopoietic cells were distinguished by the CD45 expression and side scatter profiles (top), and the number of CCR7 + cells per tumor weight (bottom) is shown. (B) The percentage of CD45 + hematopoietic cells and CCR7 + cells of CD45 + cells is shown. Tumor cells derived from F10‐mock (WT; n = 8, KO; n = 9) and F10‐ccl21 (WT; n = 12, KO; n = 13) were analyzed. The plot represents individual tumor samples obtained from three to five experimental repeats with two to four mice in each group. The data were analyzed using the Kruskal–Wallis test with the Steel–Dwass post‐hoc test. Orange lines show the median. * p < 0.05, *** p < 0.001. NS, not significant. KO, knockout; WT, wild‐type.

    Article Snippet: The cell culture supernatant was diluted 100‐fold with PBST (0.1% PBS containing 0.05% Tween20), added dropwise to a 96‐well microplate, and immobilized for 2 h. The wells were treated with 200 ng/mL biotinylated anti‐mouse CCL21 antibody (BAF457, R&D Systems) for 1 h. After washing five times with PBST, the wells were treated with HRP‐conjugated streptavidin (1:5000 dilution with PBST containing 0.1% BSA, Perkin Elmer) for 1 h. Absorbance at 650 nm was measured using a MultiScan spectrophotometer (Thermo Fisher Scientific) 15 min after the addition of SureBlue tetramethylbenzidine (TMB) peroxidase Substrate (SeraCare Life Sciences).

    Techniques: Expressing, Derivative Assay, Knock-Out

    Naïve T cells are most frequently recruited into Ccl21a ‐expressing tumors. The intratumoral CCR7 + , CD62L + , CD3 + , CD4 + , CD8 + , CD69 + , B220 + , CD11c + , and F4/80 + cell were analyzed by flow cytometry. Representative data from two independent experiments with F10‐mock ( n = 2) and F10‐ccl21 ( n = 4) in Ccl21a ‐KO mice are shown.

    Journal: Cancer Science

    Article Title: CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth

    doi: 10.1111/cas.15902

    Figure Lengend Snippet: Naïve T cells are most frequently recruited into Ccl21a ‐expressing tumors. The intratumoral CCR7 + , CD62L + , CD3 + , CD4 + , CD8 + , CD69 + , B220 + , CD11c + , and F4/80 + cell were analyzed by flow cytometry. Representative data from two independent experiments with F10‐mock ( n = 2) and F10‐ccl21 ( n = 4) in Ccl21a ‐KO mice are shown.

    Article Snippet: The cell culture supernatant was diluted 100‐fold with PBST (0.1% PBS containing 0.05% Tween20), added dropwise to a 96‐well microplate, and immobilized for 2 h. The wells were treated with 200 ng/mL biotinylated anti‐mouse CCL21 antibody (BAF457, R&D Systems) for 1 h. After washing five times with PBST, the wells were treated with HRP‐conjugated streptavidin (1:5000 dilution with PBST containing 0.1% BSA, Perkin Elmer) for 1 h. Absorbance at 650 nm was measured using a MultiScan spectrophotometer (Thermo Fisher Scientific) 15 min after the addition of SureBlue tetramethylbenzidine (TMB) peroxidase Substrate (SeraCare Life Sciences).

    Techniques: Expressing, Flow Cytometry

    Naïve T cells preferentially migrate into Ccl21a ‐expressing tumors. (A) The number of naïve T cells in the tumor‐draining lymph nodes (TDLNs) of tumor‐bearing mice. Mononuclear cells (MNCs) in the TDLNs were distinguished by the FSC/SSC profile, and frequencies of CD44 − CCR7 + naïve T cells of CD3 + cells were analyzed. Each plot shows each lymph node (LN) sample of WT or KO mice carrying F10‐mock (WT; n = 17, KO; n = 10) and F10‐ccl21a tumor (WT; n = 15, KO; n = 9). (B) F10‐mock and F10‐ccl21 tumors generated in WT mice were harvested 24 h after intravenous injection of GFP + splenocytes. MNCs in tumors derived from F10‐mock and F10‐ccl21a were distinguished by the FSC/SSC profile, and the proportion of CD62L + CD3 + naïve T cells of GFP + cells that have migrated into the tumor‐carrying WT mice are shown (F10‐mock: n = 8, F10‐ccl21: n = 10). The data were analyzed by the Steel–Dwass test or the Mann–Whitney U ‐test. Orange lines show the median. * p < 0.05, NS, not significant. KO, knockout; WT, wild‐type.

    Journal: Cancer Science

    Article Title: CCL21‐Ser expression in melanoma cells recruits CCR7 + naïve T cells to tumor tissues and promotes tumor growth

    doi: 10.1111/cas.15902

    Figure Lengend Snippet: Naïve T cells preferentially migrate into Ccl21a ‐expressing tumors. (A) The number of naïve T cells in the tumor‐draining lymph nodes (TDLNs) of tumor‐bearing mice. Mononuclear cells (MNCs) in the TDLNs were distinguished by the FSC/SSC profile, and frequencies of CD44 − CCR7 + naïve T cells of CD3 + cells were analyzed. Each plot shows each lymph node (LN) sample of WT or KO mice carrying F10‐mock (WT; n = 17, KO; n = 10) and F10‐ccl21a tumor (WT; n = 15, KO; n = 9). (B) F10‐mock and F10‐ccl21 tumors generated in WT mice were harvested 24 h after intravenous injection of GFP + splenocytes. MNCs in tumors derived from F10‐mock and F10‐ccl21a were distinguished by the FSC/SSC profile, and the proportion of CD62L + CD3 + naïve T cells of GFP + cells that have migrated into the tumor‐carrying WT mice are shown (F10‐mock: n = 8, F10‐ccl21: n = 10). The data were analyzed by the Steel–Dwass test or the Mann–Whitney U ‐test. Orange lines show the median. * p < 0.05, NS, not significant. KO, knockout; WT, wild‐type.

    Article Snippet: The cell culture supernatant was diluted 100‐fold with PBST (0.1% PBS containing 0.05% Tween20), added dropwise to a 96‐well microplate, and immobilized for 2 h. The wells were treated with 200 ng/mL biotinylated anti‐mouse CCL21 antibody (BAF457, R&D Systems) for 1 h. After washing five times with PBST, the wells were treated with HRP‐conjugated streptavidin (1:5000 dilution with PBST containing 0.1% BSA, Perkin Elmer) for 1 h. Absorbance at 650 nm was measured using a MultiScan spectrophotometer (Thermo Fisher Scientific) 15 min after the addition of SureBlue tetramethylbenzidine (TMB) peroxidase Substrate (SeraCare Life Sciences).

    Techniques: Expressing, Generated, Injection, Derivative Assay, MANN-WHITNEY, Knock-Out